Remove default channels from all remaining modules

[jfy133]

Includes replacement of (deprecated) KRONADB module with the replacement (does not require any workflow changes)

And a couple of minor version bumps

PR checklist

• This comment contains a description of changes (with reason).
• If you've fixed a bug or added code that should be tested, add tests!
• If you've added a new tool - have you followed the pipeline conventions in the contribution docs
• If necessary, also make a PR on the nf-core/mag branch on the nf-core/test-datasets repository.
• Make sure your code lints (nf-core pipelines lint).
• Ensure the test suite passes (nextflow run . -profile test,docker --outdir <OUTDIR>).
• Check for unexpected warnings in debug mode (nextflow run . -profile debug,test,docker --outdir <OUTDIR>).
• Usage Documentation in docs/usage.md is updated.
• Output Documentation in docs/output.md is updated.
• CHANGELOG.md is updated.
• README.md is updated (including new tool citations and authors/contributors).

[github-actions]

This PR is against the main branch ❌

• Do not close this PR
• Click Edit and change the base to dev
• This CI test will remain failed until you push a new commit

---

Hi @jfy133,

It looks like this pull-request is has been made against the nf-core/mag main branch.
The main branch on nf-core repositories should always contain code from the latest release.
Because of this, PRs to main are only allowed if they come from the nf-core/mag dev branch.

You do not need to close this PR, you can change the target branch to dev by clicking the "Edit" button at the top of this page.
Note that even after this, the test will continue to show as failing until you push a new commit.

Thanks again for your contribution!

[github-actions]

nf-core pipelines lint overall result: Passed ✅ ⚠️

Posted for pipeline commit 7ab25ce

+| ✅ 335 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗  47 tests had warnings |!

❗ Test warnings:

• pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
• pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
• pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
• pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
• pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
• local_component_structure - cat.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bin_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - krona.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - pool_paired_reads.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - mag_depths_plot.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - nanolyse.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_removal_build.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_assembly_build.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - mag_depths_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - split_fasta.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - tiara_classify.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - mag_depths.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - pool_single_reads.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_removal_align.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - quast_bins.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - quast.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - gtdbtk_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - cat_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - gtdbtk_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - kraken2_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - rename_predastool.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_assembly_align.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - cat_db_generate.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - kraken2.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - quast_bins_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - adjust_maxbin2_ext.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - rename_postdastool.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - cat_db.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - convert_depths.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - centrifuge.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - ancient_dna.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - binning_refinement.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - longread_preprocessing.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - depths.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - domain_classification.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - binning.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - gtdbtk.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - shortread_preprocessing.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - tiara.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - bin_qc.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - binning_preparation.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - virus_identification.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure

❔ Tests ignored:

• nextflow_config - Config default ignored: params.phix_reference
• nextflow_config - Config default ignored: params.lambda_reference

✅ Tests passed:

• files_exist - File found: .gitattributes
• files_exist - File found: .gitignore
• files_exist - File found: .nf-core.yml
• files_exist - File found: .editorconfig
• files_exist - File found: .prettierignore
• files_exist - File found: .prettierrc.yml
• files_exist - File found: CHANGELOG.md
• files_exist - File found: CITATIONS.md
• files_exist - File found: CODE_OF_CONDUCT.md
• files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
• files_exist - File found: nextflow_schema.json
• files_exist - File found: nextflow.config
• files_exist - File found: README.md
• files_exist - File found: .github/.dockstore.yml
• files_exist - File found: .github/CONTRIBUTING.md
• files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
• files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
• files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
• files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
• files_exist - File found: .github/workflows/branch.yml
• files_exist - File found: .github/workflows/ci.yml
• files_exist - File found: .github/workflows/linting_comment.yml
• files_exist - File found: .github/workflows/linting.yml
• files_exist - File found: assets/email_template.html
• files_exist - File found: assets/email_template.txt
• files_exist - File found: assets/sendmail_template.txt
• files_exist - File found: assets/nf-core-mag_logo_light.png
• files_exist - File found: conf/modules.config
• files_exist - File found: conf/test.config
• files_exist - File found: conf/test_full.config
• files_exist - File found: docs/images/nf-core-mag_logo_light.png
• files_exist - File found: docs/images/nf-core-mag_logo_dark.png
• files_exist - File found: docs/output.md
• files_exist - File found: docs/README.md
• files_exist - File found: docs/README.md
• files_exist - File found: docs/usage.md
• files_exist - File found: main.nf
• files_exist - File found: assets/multiqc_config.yml
• files_exist - File found: conf/base.config
• files_exist - File found: conf/igenomes.config
• files_exist - File found: conf/igenomes_ignored.config
• files_exist - File found: .github/workflows/awstest.yml
• files_exist - File found: .github/workflows/awsfulltest.yml
• files_exist - File found: modules.json
• files_exist - File found: ro-crate-metadata.json
• files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
• files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
• files_exist - File not found check: .github/workflows/push_dockerhub.yml
• files_exist - File not found check: .markdownlint.yml
• files_exist - File not found check: .nf-core.yaml
• files_exist - File not found check: .yamllint.yml
• files_exist - File not found check: bin/markdown_to_html.r
• files_exist - File not found check: conf/aws.config
• files_exist - File not found check: docs/images/nf-core-mag_logo.png
• files_exist - File not found check: lib/Checks.groovy
• files_exist - File not found check: lib/Completion.groovy
• files_exist - File not found check: lib/NfcoreTemplate.groovy
• files_exist - File not found check: lib/Utils.groovy
• files_exist - File not found check: lib/Workflow.groovy
• files_exist - File not found check: lib/WorkflowMain.groovy
• files_exist - File not found check: lib/WorkflowMag.groovy
• files_exist - File not found check: parameters.settings.json
• files_exist - File not found check: pipeline_template.yml
• files_exist - File not found check: Singularity
• files_exist - File not found check: lib/nfcore_external_java_deps.jar
• files_exist - File not found check: .travis.yml
• nextflow_config - Found nf-schema plugin
• nextflow_config - Config variable found: manifest.name
• nextflow_config - Config variable found: manifest.nextflowVersion
• nextflow_config - Config variable found: manifest.description
• nextflow_config - Config variable found: manifest.version
• nextflow_config - Config variable found: manifest.homePage
• nextflow_config - Config variable found: timeline.enabled
• nextflow_config - Config variable found: trace.enabled
• nextflow_config - Config variable found: report.enabled
• nextflow_config - Config variable found: dag.enabled
• nextflow_config - Config variable found: process.cpus
• nextflow_config - Config variable found: process.memory
• nextflow_config - Config variable found: process.time
• nextflow_config - Config variable found: params.outdir
• nextflow_config - Config variable found: params.input
• nextflow_config - Config variable found: validation.help.enabled
• nextflow_config - Config variable found: manifest.mainScript
• nextflow_config - Config variable found: timeline.file
• nextflow_config - Config variable found: trace.file
• nextflow_config - Config variable found: report.file
• nextflow_config - Config variable found: dag.file
• nextflow_config - Config variable found: validation.help.beforeText
• nextflow_config - Config variable found: validation.help.afterText
• nextflow_config - Config variable found: validation.help.command
• nextflow_config - Config variable found: validation.summary.beforeText
• nextflow_config - Config variable found: validation.summary.afterText
• nextflow_config - Config variable (correctly) not found: params.nf_required_version
• nextflow_config - Config variable (correctly) not found: params.container
• nextflow_config - Config variable (correctly) not found: params.singleEnd
• nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
• nextflow_config - Config variable (correctly) not found: params.name
• nextflow_config - Config variable (correctly) not found: params.enable_conda
• nextflow_config - Config variable (correctly) not found: params.max_cpus
• nextflow_config - Config variable (correctly) not found: params.max_memory
• nextflow_config - Config variable (correctly) not found: params.max_time
• nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
• nextflow_config - Config variable (correctly) not found: params.validationLenientMode
• nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
• nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
• nextflow_config - Config timeline.enabled had correct value: true
• nextflow_config - Config report.enabled had correct value: true
• nextflow_config - Config trace.enabled had correct value: true
• nextflow_config - Config dag.enabled had correct value: true
• nextflow_config - Config manifest.name began with nf-core/
• nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
• nextflow_config - Config dag.file ended with .html
• nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
• nextflow_config - Config manifest.version ends in dev: 4.1.0dev
• nextflow_config - Config params.custom_config_version is set to master
• nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
• nextflow_config - Lines for loading custom profiles found
• nextflow_config - nextflow.config contains configuration profile test
• nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
• nextflow_config - Config default value correct: params.custom_config_version= master
• nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
• nextflow_config - Config default value correct: params.publish_dir_mode= copy
• nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
• nextflow_config - Config default value correct: params.validate_params= true
• nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
• nextflow_config - Config default value correct: params.spades_fix_cpus= -1
• nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
• nextflow_config - Config default value correct: params.metabat_rng_seed= 1
• nextflow_config - Config default value correct: params.clip_tool= fastp
• nextflow_config - Config default value correct: params.reads_minlength= 15
• nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
• nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
• nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
• nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
• nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
• nextflow_config - Config default value correct: params.bbnorm_target= 100
• nextflow_config - Config default value correct: params.bbnorm_min= 5
• nextflow_config - Config default value correct: params.longreads_min_length= 1000
• nextflow_config - Config default value correct: params.longreads_keep_percent= 90
• nextflow_config - Config default value correct: params.longreads_length_weight= 10
• nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
• nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
• nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz
• nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
• nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
• nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
• nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
• nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
• nextflow_config - Config default value correct: params.spades_downstreaminput= scaffolds
• nextflow_config - Config default value correct: params.genomad_min_score= 0.7
• nextflow_config - Config default value correct: params.genomad_splits= 1
• nextflow_config - Config default value correct: params.binning_map_mode= group
• nextflow_config - Config default value correct: params.min_contig_size= 1500
• nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
• nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
• nextflow_config - Config default value correct: params.bin_min_size= 0
• nextflow_config - Config default value correct: params.bin_concoct_chunksize= 10000
• nextflow_config - Config default value correct: params.bin_concoct_overlap= 0
• nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
• nextflow_config - Config default value correct: params.tiara_min_length= 3000
• nextflow_config - Config default value correct: params.binqc_tool= busco
• nextflow_config - Config default value correct: params.busco_db_lineage= auto
• nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
• nextflow_config - Config default value correct: params.checkm2_db_version= 14897628
• nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
• nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
• nextflow_config - Config default value correct: params.gunc_database_type= progenomes
• nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
• nextflow_config - Config default value correct: params.freebayes_ploidy= 1
• nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
• nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
• nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
• nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
• nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
• files_unchanged - .gitattributes matches the template
• files_unchanged - .prettierrc.yml matches the template
• files_unchanged - CODE_OF_CONDUCT.md matches the template
• files_unchanged - LICENSE matches the template
• files_unchanged - .github/.dockstore.yml matches the template
• files_unchanged - .github/CONTRIBUTING.md matches the template
• files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
• files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
• files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
• files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
• files_unchanged - .github/workflows/branch.yml matches the template
• files_unchanged - .github/workflows/linting_comment.yml matches the template
• files_unchanged - .github/workflows/linting.yml matches the template
• files_unchanged - assets/email_template.html matches the template
• files_unchanged - assets/email_template.txt matches the template
• files_unchanged - assets/sendmail_template.txt matches the template
• files_unchanged - assets/nf-core-mag_logo_light.png matches the template
• files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
• files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
• files_unchanged - docs/README.md matches the template
• files_unchanged - .gitignore matches the template
• files_unchanged - .prettierignore matches the template
• actions_ci - '.github/workflows/ci.yml' is triggered on expected events
• actions_ci - '.github/workflows/ci.yml' checks minimum NF version
• actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
• actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
• actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
• readme - README Nextflow minimum version badge matched config. Badge: 25.04.2, Config: 25.04.2
• readme - README Zenodo placeholder was replaced with DOI.
• plugin_includes - No wrong validation plugin imports have been found
• pipeline_name_conventions - Name adheres to nf-core convention
• template_strings - Did not find any Jinja template strings (0 files)
• schema_lint - Schema lint passed
• schema_lint - Schema title + description lint passed
• schema_lint - Input mimetype lint passed: 'text/csv'
• schema_params - Schema matched params returned from nextflow config
• system_exit - No System.exit calls found
• actions_schema_validation - Workflow validation passed: ci.yml
• actions_schema_validation - Workflow validation passed: awsfulltest.yml
• actions_schema_validation - Workflow validation passed: linting.yml
• actions_schema_validation - Workflow validation passed: branch.yml
• actions_schema_validation - Workflow validation passed: linting_comment.yml
• actions_schema_validation - Workflow validation passed: download_pipeline.yml
• actions_schema_validation - Workflow validation passed: clean-up.yml
• actions_schema_validation - Workflow validation passed: awstest.yml
• actions_schema_validation - Workflow validation passed: fix-linting.yml
• actions_schema_validation - Workflow validation passed: release-announcements.yml
• actions_schema_validation - Workflow validation passed: template_version_comment.yml
• merge_markers - No merge markers found in pipeline files
• modules_json - Only installed modules found in modules.json
• multiqc_config - assets/multiqc_config.yml found and not ignored.
• multiqc_config - assets/multiqc_config.yml contains report_section_order
• multiqc_config - assets/multiqc_config.yml contains export_plots
• multiqc_config - assets/multiqc_config.yml contains report_comment
• multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
• multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
• multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
• modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
• base_config - conf/base.config found and not ignored.
• base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
• base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
• base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
• base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
• base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
• base_config - FILTLONG found in conf/base.config and Nextflow scripts.
• base_config - CENTRIFUGE_CENTRIFUGE found in conf/base.config and Nextflow scripts.
• base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
• base_config - KRONA_KTIMPORTTAXONOMY found in conf/base.config and Nextflow scripts.
• base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
• base_config - CAT found in conf/base.config and Nextflow scripts.
• base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
• base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
• base_config - SPADES found in conf/base.config and Nextflow scripts.
• base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
• base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
• base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
• base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
• base_config - BUSCO_BUSCO found in conf/base.config and Nextflow scripts.
• base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
• base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
• base_config - CHECKM_LINEAGEWF found in conf/base.config and Nextflow scripts.
• base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
• modules_config - conf/modules.config found and not ignored.
• modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
• modules_config - FASTP found in conf/modules.config and Nextflow scripts.
• modules_config - TRIMMOMATIC found in conf/modules.config and Nextflow scripts.
• modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
• modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
• modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
• modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
• modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
• modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
• modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
• modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
• modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
• modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
• modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
• modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
• modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
• modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
• modules_config - CENTRIFUGE_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
• modules_config - CENTRIFUGE_KREPORT found in conf/modules.config and Nextflow scripts.
• modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
• modules_config - KREPORT2KRONA_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
• modules_config - KRONA_KTIMPORTTAXONOMY found in conf/modules.config and Nextflow scripts.
• modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
• modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
• modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
• modules_config - QUAST found in conf/modules.config and Nextflow scripts.
• modules_config - QUAST_BINS found in conf/modules.config and Nextflow scripts.
• modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
• modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
• modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
• modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - BUSCO_UNTAR found in conf/modules.config and Nextflow scripts.
• modules_config - BUSCO_BUSCO found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM_UNTAR found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
• modules_config - CONCAT_BINQC_TSV found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
• modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
• modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
• modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
• modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
• modules_config - CAT found in conf/modules.config and Nextflow scripts.
• modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
• modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
• modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
• modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
• modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
• modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
• modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
• modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
• modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
• modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
• modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
• modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
• modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
• modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
• modules_config - CONCOCT_CUTUPFASTA found in conf/modules.config and Nextflow scripts.
• modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
• modules_config - SEQKIT_STATS found in conf/modules.config and Nextflow scripts.
• modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
• modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
• modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
• modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
• modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
• modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
• modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
• nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
• nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.2.1

Run details

• nf-core/tools version 3.2.1
• Run at 2025-05-29 06:52:37

[dialvarezs]

KRONADB module should be removed, right?

[jfy133]

Good catch @dialvarezs !

Done that now, otherwise looks good?

[jfy133]

@nf-core-bot fix linting

[dialvarezs]

Yes! Looks good now